hsa_circ_0085616
 GeneASAP1OrganismHuman
 Genome Locuschr8:131370262-131374017:-Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28974900
 Experimental Method
 Sample TypeColorectal TissuesComparison60 GC tissues and paired adjacent non-tumor tissues, as well as 60 plasma samples from GC patients and 60 plasma samples from healthy controls
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GACTACAACTCGCCCACCAC

Reverse

TCCATTTCTGGGCCATAATC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Huang, M, He, YR, Liang, LC, Huang, Q, Zhu, ZQ (2017). Circular RNA hsa_circ_0000745 may serve as a diagnostic marker for gastric cancer. World J. Gastroenterol., 23, 34:6330-6338.