hsa_circ_0091017
 GeneTAF1OrganismHuman
 Genome LocuschrX:70601592-70607311:+Buildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID29151929
 Experimental Method
 Sample TypeTissuesComparisonfive matched samples of bladder cancer and adjacent non-tumour tissue
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ATCATTCGGACAAGACAGG

Reverse

TCCATATACCAGATCCTCATTG

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Yang, X, Yuan, W, Tao, J, Li, P, Yang, C, Deng, X, Zhang, X, Tang, J, Han, J, Wang, J, Li, P, Lu, Q, Gu, M (2017). Identification of circular RNA signature in bladder cancer. J Cancer, 8, 17:3456-3463.