hsa_circ_100219
 GeneFAF1OrganismHuman
 Genome Locuschr1:51121113-51210447:-Buildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID28484086
 Experimental Method
 Sample TypeTissuesComparisonBreast cancer lesions and adjacent normal-appearing tissues were collected from patients who underwent surgical breast resection
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TGCTACAGACGACTCAGAGA

Reverse

AGATGATGAAGGTGGTGGCA

StatisticsFold Change : Downregulated
pvalue : p<0.001
 Citation
Lü, L, Sun, J, Shi, P, Kong, W, Xu, K, He, B, Zhang, S, Wang, J (2017). Identification of circular RNAs as a promising new class of diagnostic biomarkers for human breast cancer. Oncotarget, 8, 27:44096-44107.