circad | circRNAs associated with diseases
hsa_circ_406697
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID28484086
 Experimental Method
 Sample TypeTissuesComparison51 breast cancer samples, matched with adjacent normal-appearing tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GAGACAGATTTAAGGCCTGCC

Reverse

GGTAGATGTGGCTTTCCCCA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Lü, L, Sun, J, Shi, P, Kong, W, Xu, K, He, B, Zhang, S, Wang, J (2017). Identification of circular RNAs as a promising new class of diagnostic biomarkers for human breast cancer. Oncotarget, 8, 27:44096-44107.