mmu-circRNA-7063
 Genen/aOrganismMouse
 Genome Locuschr13:116893000-116902856:-Buildn/a
 DiseaseOsteoarthritis (OA)ICD-10 Polyarthrosis, unspecified (M15.9)
 DBLinkLink to databasePMID29247798
 Experimental Method
 Sample TypeMouse Articular Chondrocytes (MACs)ComparisonMouse Articular Chondrocytes (MACs) were cultured in DMEM medium with and without IL-1β stimulation
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ATATTGTGTGGTGTGTGATGA ACC

Reverse

TCCCAATCCAAACCGCTCT

StatisticsFold Change : Upregulated,3.621618
pvalue : p=0.040911
 Citation
Zhou, Z, Du, D, Chen, A, Zhu, L (2018). Circular RNA expression profile of articular chondrocytes in an IL-1β-induced mouse model of osteoarthritis. Gene, 644:20-26.