mmu_circRNA_002007
 GeneFLNBOrganismMouse
 Genome Locusn/aBuildn/a
 DiseaseMyocardial infarction induced heart failureICD-10 Cardiovascular disease, unspecified (I51.6)
 DBLinkLink to databasePMID27336675
 Experimental Method
 Sample TypeHeart VentriclesComparisonTen mice each group were euthanized and 20 mg left ventricular tissues was collected and stored in liquid nitrogen
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AGCTGGCGTGGGGGACATC

Reverse

GCTGTGTAGATGTCAAAATAG

StatisticsFold Change : Downregulated,2.197
pvalue : p<0.05
 Citation
Wu, HJ, Zhang, CY, Zhang, S, Chang, M, Wang, HY (2016). Microarray Expression Profile of Circular RNAs in Heart Tissue of Mice with Myocardial Infarction-Induced Heart Failure. Cell. Physiol. Biochem., 39, 1:205-16.