mmu_circRNA_003540
 Genen/aOrganismMouse
 Genome Locusn/aBuildn/a
 DiseaseAlzheimer's diseaseICD-10 Alzheimer’s disease (G30)
 DBLinkLink to databasePMID29448241
 Experimental Method
 Sample TypeHippocampal TissuesComparisonhippocampal tissues of SAMP8 and SAMR1
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TGACTGACGGCTCTGTTCTG

Reverse

CAATTGTTACCTGCCCCATC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Huang, JL, Qin, MC, Zhou, Y, Xu, ZH, Yang, SM, Zhang, F, Zhong, J, Liang, MK, Chen, B, Zhang, WY, Wu, DP, Zhong, ZG (2018). Comprehensive analysis of differentially expressed profiles of Alzheimer’s disease associated circular RNAs in an Alzheimer'sdisease mouse model. Aging (Albany NY), 10, 2:253-265.