mmu_circRNA_007687
 GeneHELZOrganismMouse
 Genome Locusn/aBuildn/a
 DiseaseMyocardial infarction induced heart failureICD-10 Cardiovascular disease, unspecified (I51.6)
 DBLinkLink to databasePMID27336675
 Experimental Method
 Sample TypeHeart VentriclesComparisonTen mice each group were euthanized and 20 mg left ventricular tissues was collected and stored in liquid nitrogen
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AACTTCTCAATACGGCCATCAC

Reverse

TCAAATCTTTCGTTACCATCCC

StatisticsFold Change : Upregulated,2.033
pvalue : p=0.001
 Citation
Wu, HJ, Zhang, CY, Zhang, S, Chang, M, Wang, HY (2016). Microarray Expression Profile of Circular RNAs in Heart Tissue of Mice with Myocardial Infarction-Induced Heart Failure. Cell. Physiol. Biochem., 39, 1:205-16.