mmu_circRNA_30884
 Genen/aOrganismMouse
 Genome Locusn/aBuildn/a
 DiseaseOsteogenesisICD-10 Osteogenesis imperfecta (Q78.0)
 DBLinkLink to databasePMID29700558
 Experimental Method
 Sample TypeMouse Adipose-Derived Stromal CellsComparisonOsteogenic Differentiation of mADSCs at Different Stages
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CATCCCTTCCTGGCTAAATAC

Reverse

GGCCACCAATATATAATTCTCAC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Long, T, Guo, Z, Han, L, Yuan, X, Liu, L, Jing, W, Tian, W, Zheng, XH, Tang, W, Long, J (2018). Differential Expression Profiles of Circular RNAs During Osteogenic Differentiation of Mouse Adipose-Derived Stromal Cells. Calcif. Tissue Int., :np page given.