mmu_circRNA_40806
 Genen/aOrganismMouse
 Genome Locusn/aBuildn/a
 DiseaseIschemic brain after strokeICD-10 Stroke, not specified as haemorrhage or infarction (I64)
 DBLinkLink to databasePMID29156814
 Experimental Method
 Sample TypeBrain TissuesComparisonIschemic brain tissues before and after stroke, which was induced by 45 min of transient Middle Cerebral Artery Occlusion (MCAO).
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CGGTATTGGAATGAGTGGAA

Reverse

TATGAGGGAGGACTCTTAGCA

StatisticsFold Change : Downregulated,0.417897758
pvalue : p=0.000152
 Citation
Liu, C, Zhang, C, Yang, J, Geng, X, Du, H, Ji, X, Zhao, H (2017). Screening circular RNA expression patterns following focal cerebral ischemia in mice. Oncotarget, 8, 49:86535-86547.