mmu_circ_0001052/circHIPK3
 GeneHIPK3OrganismMouse
 Genome Locuschr2:104310905-104312004:-Buildn/a
 DiseaseDiabetes mellitusICD-10 Diabetes mellitus (E10-E14)
 DBLinkLink to databasePMID28860123
 Experimental Method
 Sample TypeHuman Umbilical Vein Endothelial Cells (HUVECs)ComparisonC57BL/6 mice control vs diabetic
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TATGTTGGTGGATCCTGTTCGGCA

Reverse

TGGTGGGTAGACCAAGACTTGTGA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Shan, K, Liu, C, Liu, BH, Chen, X, Dong, R, Liu, X, Zhang, YY, Liu, B, Zhang, SJ, Wang, JJ, Zhang, SH, Wu, JH, Zhao, C, Yan, B (2017). Circular Noncoding RNA HIPK3 Mediates Retinal Vascular Dysfunction in Diabetes Mellitus. Circulation, 136, 17:1629-1642.