Aliases circRNA_0962 Scientific name Bombyx mori
Organism Silkworm Genome Locus NW_004581687.1:1660959-1664189:+
CircRNA type sense-overlapping Gene ID n/a
Gene Name LOC101740441 Detection pipeline find_circ
Sample Type midgut following Bombyx mori cytoplasmic polyhedrosis virus infection
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Aliases circRNA_0962 Scientific name Bombyx mori
Organism Silkworm Genome Locus n/a
CircRNA type sense-overlapping Gene ID n/a
Gene Name LOC101740441 Detection pipeline find_circ
Sample Type midgut following Bombyx mori cytoplasmic polyhedrosis virus infection
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GATCTCAGGAGTACCGCGTTG
Reverse Primer TCTGGCGCAGGAAGTGAAACG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size