| Aliases | Cs-circRNA1971 | Scientific name | Camellia sinensis | ||||
| Organism | Tea | Genome Locus | Sc0003945:69943-71869:+ | ||||
| CircRNA type | circRNA | Gene ID | n/a | ||||
| Gene Name | CSA019738 | Detection pipeline | CIRCexplorer and CIRI2 | ||||
| Sample Type | Leaf bud and young leaf | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | Cs-circRNA1971 | Scientific name | Camellia sinensis | ||||
| Organism | Tea | Genome Locus | Sc0003945:69943-71869:+ | ||||
| CircRNA type | circRNA | Gene ID | N/A | ||||
| Gene Name | CSA010962 | Detection pipeline | CIRCexplorer;CIRI | ||||
| Sample Type | Leaf bud and young leaf | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACACTGTGGAAGGCCAATGGCAG | ||||||||
| Reverse Primer | TGCGAAGCTCCAGACCGTCA | ||||||||
| Aliases | Cs-circRNA1971 | Scientific name | Camellia sinensis | ||||
| Organism | Tea | Genome Locus | Sc0003945:69943-71869:+ | ||||
| CircRNA type | circRNA | Gene ID | N/A | ||||
| Gene Name | CSA000266 | Detection pipeline | CIRCexplorer;CIRI | ||||
| Sample Type | Leaf bud and young leaf | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CAGCATGGGGTGTGGAGGCTCG | ||||||||
| Reverse Primer | ACTCATGGTGGCGAGTGCCAA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |