| Aliases | dlg1_circ | Scientific name | Drosophila melanogaster | ||||
| Organism | Fruit fly | Genome Locus | chrX:11291859-11292855:. | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | dlg | Detection pipeline | n/a | ||||
| Sample Type | Neural Tissues | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCGCAAATTTCCGTTTATGA | ||||||||
| Reverse Primer | GGCGGCTAGGACATTTGTAG | ||||||||