Aliases Gm08circRNA1976 Scientific name Glycine max
Organism Soybean Genome Locus Gm08:20249684-20256693:-
CircRNA type exonic Gene ID n/a
Gene Name EMB156 Detection pipeline CIRI
Sample Type leaf;root and stem tissues
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Aliases Gm08circRNA1976 Scientific name Glycine max
Organism Soybean Genome Locus Gm08:20249684-20256693:-
CircRNA type exonic Gene ID n/a
Gene Name EMB156 Detection pipeline CIRI
Sample Type leaf;root and stem tissues
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGTAGTAGCTCATGGTGGTC
Reverse Primer ACCCATACCCTCAAGCAGTT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size