| Aliases | HSA_CIRCpedia_20608 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:38638380-38638668 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | BJ;HeLa_S3;NHEK;AG04450;HepG2;A549;Hs68 | ||||||||
| Method for Estimation | poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_007374 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:38638380-38638668:- | ||||
| CircRNA type | n/a | Gene ID | ENSG00000131746.8 | ||||
| Gene Name | TNS4 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ7374/TNS4 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr17:38638380-38638668 | ||||
| CircRNA type | N/A | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | N/A | ||||
| Sample Type | Colorectal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CAGACGACTCGATGAGGAAGTG | ||||||||
| Reverse Primer | CAAACTCACCATCCCACAGAGA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |