Aliases circRNA9777 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:16081913-16093753:+
CircRNA type circRNA Gene ID ENSG00000167460.15
Gene Name TPM4 Detection pipeline find_circ
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circRNA9777 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:16081913-16093753:+
CircRNA type N/A Gene ID ENSG00000167460.15
Gene Name TPM4 Detection pipeline N/A
Sample Type Esophageal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GCAAAACTGGAAAAGACAAT
Reverse Primer TCCAACTCCTCCTCAACG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
121 CAGTCCATGCAGCGTATAGT tctgtggcttctcttACGCA 50 50 57.484 59.034 94 214 20 20
114 GTCCATGCAGCGTATAGTATGT ggcttctcttACGCACACAG 45.455 55 58.086 58.928 96 209 22 20
281 CCATGCAGCGTATAGTATGTTAC acctgccatccacatacctt 43.478 50 57.237 58.701 98 378 23 20
281 CCATGCAGCGTATAGTATGTTAC acctgccatccacatacctt 43.478 50 57.237 58.701 98 378 23 20
121 CAGTCCATGCAGCGTATAGT tctgtggcttctcttACGCA 50 50 57.484 59.034 94 214 20 20
114 GTCCATGCAGCGTATAGTATGT ggcttctcttACGCACACAG 45.455 55 58.086 58.928 96 209 22 20
121 CAGTCCATGCAGCGTATAGT tctgtggcttctcttACGCA 50 50 57.484 59.034 94 214 20 20
114 GTCCATGCAGCGTATAGTATGT ggcttctcttACGCACACAG 45.455 55 58.086 58.928 96 209 22 20
281 CCATGCAGCGTATAGTATGTTAC acctgccatccacatacctt 43.478 50 57.237 58.701 98 378 23 20