Aliases hsa_circ_0051239 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:41938372-41945481:-
CircRNA type . Gene ID ENSG00000105341.14
Gene Name ATP5SL Detection pipeline .
Sample Type K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Ag04450; Nhek; Nhlf
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_051239/hsa_circ_0051239 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr19:41938372-41945481:-
CircRNA type N/A Gene ID ENSG00000105341.14
Gene Name ATP5SL Detection pipeline N/A
Sample Type Infantile Hemangioma (IH)
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CTACAGCCACCACACACAAGT
Reverse Primer GTCCATAAGAGGAATCAGTCGT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
151 gtgtgtgtgtgtGCCCTTAG TCGAGGATGTGGGATTTGGT 55 50 59.056 58.715 188 338 20 20
206 tgtgtgtGCCCTTAGAACCT AGGAGCTAATGGACAGGCAA 50 50 58.863 58.711 193 398 20 20
169 gtgtgtgtgtgtgtGCCC GCTTGGAAGGGATTGTTCGA 61.111 50 59.202 58.179 186 354 18 20
206 tgtgtgtGCCCTTAGAACCT AGGAGCTAATGGACAGGCAA 50 50 58.863 58.711 193 398 20 20
169 gtgtgtgtgtgtgtGCCC GCTTGGAAGGGATTGTTCGA 61.111 50 59.202 58.179 186 354 18 20
151 gtgtgtgtgtgtGCCCTTAG TCGAGGATGTGGGATTTGGT 55 50 59.056 58.715 188 338 20 20