Aliases hsa_circ_0054633 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:55861197-55913579:-
CircRNA type . Gene ID ENSG00000138035.10
Gene Name PNPT1 Detection pipeline .
Sample Type Helas3
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0054633 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:55861197-55913579:-
CircRNA type N/A Gene ID ENSG00000138035.10
Gene Name PNPT1 Detection pipeline N/A
Sample Type Pre-diabetes and type 2 Diabetes mellitus
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TTGCTTTCTACACTTTCAGGTGAC
Reverse Primer GCTTTTTGTCTGTAGTCAACCACCA
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
180 ACCCTGAGTCATGAATTTACCtt AACCTTCCCCTTCCCAGTTT 39.13 50 57.479 58.759 177 356 23 20
180 ACCCTGAGTCATGAATTTACCtt AACCTTCCCCTTCCCAGTTT 39.13 50 57.479 58.759 177 356 23 20