Aliases HSA_CIRCpedia_43952 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver;Liver_N19
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr3|146102754-146124229 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:146102754-146124229:n/a
CircRNA type circRNA Gene ID NA
Gene Name NA Detection pipeline CIRCexplorer2
Sample Type PDLSC osteogenis
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002479 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type ERR688858
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000705 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR837797
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000026 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR922112
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002410 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1643177
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002922 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1643179
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004340 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1643200
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000022 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1643525
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000843 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1706775
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000129 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1706776
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000890 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1706784
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000742 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1706787
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000647 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1706831
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000856 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1706839
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000969 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1706846
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006375 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1931812
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006016 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1931813
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006748 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1931814
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006709 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1931819
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_031863 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1363096
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_028651 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1363098
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_033150 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1363099
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_029850 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR1363100
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008248 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131508
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_018462 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131525
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_010425 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131526
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009162 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131527
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001356 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131528
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_018512 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131529
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006621 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131531
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000966 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131532
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_010113 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131533
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001149 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131534
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_016902 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131535
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001152 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131536
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_018497 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131537
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_016112 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131538
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001176 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131539
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_016670 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131540
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_027550 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131541
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_027462 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131542
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_026453 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131543
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_021653 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131544
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_023334 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2131546
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000759 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2654009
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001218 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2654022
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000720 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2654036
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002293 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2924725
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004016 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2924727
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005063 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR2924729
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009115 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084933
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005940 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084935
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006877 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084940
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005196 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084947
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000957 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084948
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006461 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084950
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005481 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084951
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005092 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084952
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008334 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084953
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006801 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR3084954
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000831 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR954226
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000895 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR954227
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000923 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR954233
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001749 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type . Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline .
Sample Type SRR954234
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases test_circ_004006 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type 0 Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_004006 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type 0 Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases circRNA PLOD2 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:146102754-146124229:-
CircRNA type N/A Gene ID ENSG00000152952.11
Gene Name PLOD2 Detection pipeline N/A
Sample Type PDLSC osteogenis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ATCACTTTCTTTTGTTGCTACAGTT
Reverse Primer GGCAATTAATGGAAATGGACCC
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
360 GAATACAGACACACACACACGT ACCAAATGCTATCTTCCTTGTGA 45.455 39.13 58.879 58.078 40 399 22 23
221 ACAGACACACACACACGTATT GACTGCATAAATCGATGGAATCC 42.857 43.478 57.826 57.711 44 264 21 23
307 CAGACACACGAATACAGACACA AGGCACACATTATAGGATCTTCA 45.455 39.13 58.362 57.106 31 337 22 23
231 CACACACATACACACACAGACA ATCCATCACTTTCTTTTGTTGCT 45.455 34.783 58.806 57.204 15 245 22 23
184 tggtttggcttcctagtctca aaatcaccctgacgctagct 47.619 50 58.665 59.095 41 224 21 20
190 ccttggtttggcttcctagtc tggaaatcaccctgacgcta 52.381 50 58.563 58.728 38 227 21 20
167 gcttcctagtctcaagaggttt gacgctagctgtcgaagtct 45.455 55 57.455 59.551 48 214 22 20
185 tggcttcctagtctcaagagg tcctggaaatcaccctgacg 52.381 55 58.538 59.387 46 230 21 20
176 ccaatagactagacttcgacagc caatctgccagtcccagga 47.826 57.895 58.397 59.006 185 360 23 19
124 ttccaaagaaaagccacaataca tctgtcctggaaatcaccct 34.783 50 57.139 57.955 111 234 23 20