| Aliases | circRNA5669 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:136046851-136062687:+ | ||||
| CircRNA type | circRNA | Gene ID | ENSG00000120708.16 | ||||
| Gene Name | TGFBI | Detection pipeline | find_circ | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA5669 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:136046851-136062687:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000120708.16 | ||||
| Gene Name | TGFBI | Detection pipeline | N/A | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CAAGCATCAGCGTTTTC | ||||||||
| Reverse Primer | TATGGTAGCGGAGGGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |
| 121 | TTCTCCCCACCAGCTCATAC | ataattgaagtgccacaggtttt | 55 | 34.783 | 58.796 | 57.193 | 113 | 233 | 20 | 23 | |
| 121 | TTCTCCCCACCAGCTCATAC | ataattgaagtgccacaggtttt | 55 | 34.783 | 58.796 | 57.193 | 113 | 233 | 20 | 23 | |
| 121 | TTCTCCCCACCAGCTCATAC | ataattgaagtgccacaggtttt | 55 | 34.783 | 58.796 | 57.193 | 113 | 233 | 20 | 23 | |