Aliases hsa_circ_0001649 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113:-
CircRNA type . Gene ID ENSG00000146414.11
Gene Name SHPRH Detection pipeline .
Sample Type cd_19; Hs68_RNase; Hs68_control; K562; H1hesc; Gm12878; Ag04450; A549; Nhek; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_53812 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T15;Forebrain;Diencephalon;K562;Stomach;SH-SY5Y_D0_exp2;H1;Cortex;Liver_N8;SH-SY5Y_D4_exp2;Cerebellum;Liver_N7;Occipital;Liver_T10;Temporal;Liver_T7;AG04450;Liver_N15;Liver_T12;Liver_T3;Liver;Parietal;Lung;Liver_N11;SH-SY5Y_D2_exp1;Thyroid;Liver_N13;Liver_N10;Liver_N14;PA1;SH-SY5Y_D8_exp2;Liver_N12;Liver_T11;SH-SY5Y_D0_exp1;GM12878;Liver_N3;Heart;Liver_T13;Liver_T8;Liver_N6;NHEK;Liver_T6;Liver_T14;Hs68;Liver_T21;Liver_T17;Liver_N22;Liver_T18;Liver_N21;Liver_N20;Liver_N18;Liver_N19;Liver_T22;Liver_N17;Liver_T19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004166 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113:-
CircRNA type n/a Gene ID ENSG00000146414.11
Gene Name SHPRH Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0001649 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113:-
CircRNA type N/A Gene ID ENSG00000146414.11
Gene Name SHPRH Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AATGCTGAAAACTGCTGAGAGAA
Reverse Primer TTGAGAAAACGAGTGCTTTGG
Aliases hsa_circRBM23 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113:-
CircRNA type N/A Gene ID ENSG00000146414.11
Gene Name SHPRH Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TATCCTAGCAATACCACCAGCA
Reverse Primer CATGGCCTCAATCACTATGTC
Aliases hsa_circ_0001649 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113:-
CircRNA type N/A Gene ID ENSG00000146414.11
Gene Name SHPRH Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AATGCTGAAAACTGCTGAGAGAA
Reverse Primer TTGAGAAAACGAGTGCTTTGG
Aliases hsa_circ_0001649 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113:-
CircRNA type N/A Gene ID ENSG00000146414.11
Gene Name SHPRH Detection pipeline N/A
Sample Type Pancreatic Ductal Adenocarcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AATGCTGAAAACTGCTGAGAGAA
Reverse Primer TTGAGAAAACGAGTGCTTTGG
Aliases hsa_circ_0001649 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:146209155-146216113:-
CircRNA type N/A Gene ID ENSG00000146414.11
Gene Name SHPRH Detection pipeline N/A
Sample Type Digestive System Neoplasm
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AATGCTGAAAACTGCTGAGAGAA
Reverse Primer TTGAGAAAACGAGTGCTTTGG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
141 TCAGTACAAACCGACTTCACA TCGCAGATGACCTCAACCA 42.857 52.632 57.195 58.639 128 268 21 19
104 ttcatcagtcagttggtgcc GCAGATGACCTCAACCACAC 50 55 58.104 58.84 163 266 20 20
301 CATTGCCTGCATTCTTTCTTCT CATGGGGTGCAGGGACAG 40.909 66.667 57.548 60.045 20 320 22 18
243 CAGTACAAACCGACTTCACATTT GTCCTGACACCTGCCTGC 39.13 66.667 57.582 60.359 129 371 23 18
277 ACAAATCAGTACAAACCGACTTC GAGGAGGCCACACATGTTTATTA 39.13 43.478 57.331 58.477 123 399 23 23
221 TCAGTACAAACCGACTTCACA CAGCTTAGAGATCCAGGGGC 42.857 60 57.195 59.604 128 348 21 20
181 ttcatcagtcagttggtgcc TAGAGATCCAGGGGCCAAAG 50 55 58.104 58.488 163 343 20 20
270 CAGTACAAACCGACTTCACATTT GCAGCCATTCTACAAAAGTGGA 39.13 45.455 57.582 59.18 129 398 23 22
307 TGCCTGCATTCTTTCTTCTATTG CCAAAGCACTCGTTTTCTCAAC 39.13 45.455 57.428 58.637 23 329 23 22
268 ACAAATCAGTACAAACCGACTTC TCTACAAAAGTGGAAGCTGTGG 39.13 45.455 57.331 58.523 123 390 23 22
221 TCAGTACAAACCGACTTCACA CAGCTTAGAGATCCAGGGGC 42.857 60 57.195 59.604 128 348 21 20
307 TGCCTGCATTCTTTCTTCTATTG CCAAAGCACTCGTTTTCTCAAC 39.13 45.455 57.428 58.637 23 329 23 22
270 CAGTACAAACCGACTTCACATTT GCAGCCATTCTACAAAAGTGGA 39.13 45.455 57.582 59.18 129 398 23 22
268 ACAAATCAGTACAAACCGACTTC TCTACAAAAGTGGAAGCTGTGG 39.13 45.455 57.331 58.523 123 390 23 22
181 ttcatcagtcagttggtgcc TAGAGATCCAGGGGCCAAAG 50 55 58.104 58.488 163 343 20 20
181 ttcatcagtcagttggtgcc TAGAGATCCAGGGGCCAAAG 50 55 58.104 58.488 163 343 20 20
221 TCAGTACAAACCGACTTCACA CAGCTTAGAGATCCAGGGGC 42.857 60 57.195 59.604 128 348 21 20
270 CAGTACAAACCGACTTCACATTT GCAGCCATTCTACAAAAGTGGA 39.13 45.455 57.582 59.18 129 398 23 22
307 TGCCTGCATTCTTTCTTCTATTG CCAAAGCACTCGTTTTCTCAAC 39.13 45.455 57.428 58.637 23 329 23 22
268 ACAAATCAGTACAAACCGACTTC TCTACAAAAGTGGAAGCTGTGG 39.13 45.455 57.331 58.523 123 390 23 22