Aliases circRNA167 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chrX:154350909-154368090:-
CircRNA type circRNA Gene ID ENSG00000196924.15
Gene Name FLNA Detection pipeline find_circ
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 29218114
Aliases circRNA167 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chrX:154350909-154368090:-
CircRNA type N/A Gene ID ENSG00000196924.15
Gene Name FLNA Detection pipeline N/A
Sample Type Esophageal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGGAGTGCTATGTCACAGAA
Reverse Primer AGTAGTGCAGGATCAGGGTC
Pubmed 29218114
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
292 acttggaatactgctctggaatg AGAGAGATGGGTAGGTGATGA 43.478 47.619 58.479 57.018 8 299 23 21
190 tcaggggtattatggtgaacaaa GTCTCTCCTGTCAAAGTAAAGCA 39.13 43.478 57.478 58.368 70 259 23 23
199 aaccagtctcaaatggtcaca GAGATGGGTAGGTGATGAGGT 42.857 52.381 57.424 58.316 98 296 21 21
255 tggaatactgctctggaatgaaa GGTGTAGTCTCTCCTGTCAAAG 39.13 50 57.822 57.819 11 265 23 22
125 tgaagaacagattaatggttgcc AGATGGGTAGGTGATGAGGTAAT 39.13 43.478 57.357 58.168 171 295 23 23
162 cctcaggggtattatggtgaac GGTAACACATTTCTAAGGGGCT 50 45.455 57.913 58.036 68 229 22 22
287 ataacttggaatactgctctgga GGGTAGGTGATGAGGTAATATGC 39.13 47.826 57.042 58.167 5 291 23 23
199 aaccagtctcaaatggtcaca GAGATGGGTAGGTGATGAGGT 42.857 52.381 57.424 58.316 98 296 21 21
162 cctcaggggtattatggtgaac GGTAACACATTTCTAAGGGGCT 50 45.455 57.913 58.036 68 229 22 22
292 acttggaatactgctctggaatg AGAGAGATGGGTAGGTGATGA 43.478 47.619 58.479 57.018 8 299 23 21
255 tggaatactgctctggaatgaaa GGTGTAGTCTCTCCTGTCAAAG 39.13 50 57.822 57.819 11 265 23 22
125 tgaagaacagattaatggttgcc AGATGGGTAGGTGATGAGGTAAT 39.13 43.478 57.357 58.168 171 295 23 23
190 tcaggggtattatggtgaacaaa GTCTCTCCTGTCAAAGTAAAGCA 39.13 43.478 57.478 58.368 70 259 23 23
287 ataacttggaatactgctctgga GGGTAGGTGATGAGGTAATATGC 39.13 47.826 57.042 58.167 5 291 23 23
199 aaccagtctcaaatggtcaca GAGATGGGTAGGTGATGAGGT 42.857 52.381 57.424 58.316 98 296 21 21
162 cctcaggggtattatggtgaac GGTAACACATTTCTAAGGGGCT 50 45.455 57.913 58.036 68 229 22 22
292 acttggaatactgctctggaatg AGAGAGATGGGTAGGTGATGA 43.478 47.619 58.479 57.018 8 299 23 21
255 tggaatactgctctggaatgaaa GGTGTAGTCTCTCCTGTCAAAG 39.13 50 57.822 57.819 11 265 23 22
190 tcaggggtattatggtgaacaaa GTCTCTCCTGTCAAAGTAAAGCA 39.13 43.478 57.478 58.368 70 259 23 23
125 tgaagaacagattaatggttgcc AGATGGGTAGGTGATGAGGTAAT 39.13 43.478 57.357 58.168 171 295 23 23
287 ataacttggaatactgctctgga GGGTAGGTGATGAGGTAATATGC 39.13 47.826 57.042 58.167 5 291 23 23