| Aliases | HSA_CIRCpedia_66207 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chrX:71137557-71137943 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Diencephalon | ||||||||
| Method for Estimation | poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chrX|71137557-71137943 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:71137557-71137943:n/a | ||||
| CircRNA type | circRNA | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | CIRCexplorer2 | ||||
| Sample Type | PDLSC osteogenis | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA_400033 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | n/an/a | ||||
| CircRNA type | n/a | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | n/a | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA_400033 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | N/A | ||||
| CircRNA type | N/A | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | N/A | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TTCGCCTCTGGTATCGTGC | ||||||||
| Reverse Primer | GTTCCCAATTCGTTCGCTCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |