Aliases chr5:32640331-32664400+ Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:32640331-32664400:+
CircRNA type N/A Gene ID ENSG00000250885.1
Gene Name LINC02061 Detection pipeline N/A
Sample Type Intestinal injury and repair
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGAGGCTGCTCTGTATGGTC
Reverse Primer CCATTATCAAATCTGGATATGGCAC
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
174 gtgcccgaggagagagatg CCAGTGGTGACTAGTTCCCA 63.158 55 59.261 58.652 86 259 19 20
122 accctgctttatggatccct AGGCCAGTGGTGACTAGTTC 50 55 58.087 59.023 141 262 20 20
202 cccgaggagagagatgtgc GGGTCTTTGCTCCACGTTTT 63.158 50 59.261 58.97 89 290 19 20
161 cacttgtgcccgaggaga CACACACAAAGGGACAAGCC 61.111 55 58.94 59.615 81 241 18 20
185 cttgtgcccgaggagagag ACTAAAGGCCAGTGGTGACT 63.158 50 59.485 58.565 83 267 19 20
175 ccctgctttatggatccctcat AGCTCACACCTGTCCATTCC 50 55 59.622 59.674 142 316 22 20
133 agaatccagGCTGACTTTTAGT ATCGCCTAGCTCACACCTG 40.909 57.895 57.082 59.181 191 323 22 19
150 ctgctttatggatccctcattct AGAGGGTCTTTGCTCCACG 43.478 57.895 58.017 59.326 144 293 23 19
124 gctctcaacaatatcattcaggg GACAAGCCACTCAACAGACT 43.478 50 57.314 57.753 106 229 23 20