Aliases | Os05circ02465 | Scientific name | Oryza sativa | ||||
Organism | Rice | Genome Locus | chr05:2395454-2396306:+ | ||||
CircRNA type | intergenic-intergenic | Gene ID | n/a | ||||
Gene Name | Os07t0672500-03 | Detection pipeline | n/a |
Sample Type | Panicles and mature leaves | ||||||||
Method for Estimation | Quantitative PCR | ||||||||
Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
Primers (Experimented) | |||||||||
Primers (Validated) | |||||||||
Forward Primer | ctccattccattttgcagtg | ||||||||
Reverse Primer | tcaatgtgatttggatgcttg |