| Aliases | IWGSC_CSS_4DS_scaff_2307013:2345|3583 | Scientific name | Triticum aestivum | ||||
| Organism | Wheat | Genome Locus | IWGSC_CSS_4DS_scaff_2307013:2344-3583:- | ||||
| CircRNA type | exonic | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | CIRI | ||||
| Sample Type | wheat leaves | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | IWGSC_CSS_4DS_scaff_2307013:2345|3583 | Scientific name | Triticum aestivum | ||||
| Organism | Wheat | Genome Locus | IWGSC_CSS_4DS_scaff_2307013:2345-3583:- | ||||
| CircRNA type | exonic | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | CIRI | ||||
| Sample Type | wheat leaves | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCCATTTAAAAACTTGCGTGA | ||||||||
| Reverse Primer | GTGCCTTAACAGCCCTCTTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |