Aliases circ2000 Scientific name Zea mays
Organism Maize Genome Locus chr6:134578628-134579338:-
CircRNA type n/a Gene ID n/a
Gene Name GRMZM2G329033 Detection pipeline KNIFE
Sample Type third leaves of B73 V3 stage seedlings
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Aliases circ2000 Scientific name Zea mays
Organism Maize Genome Locus chr6:134578628-134579338:-
CircRNA type n/a Gene ID n/a
Gene Name GRMZM2G329033 Detection pipeline KNIFE
Sample Type third leaves of B73 V3 stage seedlings
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GAGGACCAAGAATCGTTGGAA
Reverse Primer CAGATTCTCCAGGGGTATTATAATC
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
363 TCGGACGAAGGTTATGAAGGA GGCTCCCATTCTCAACAAGG 47.619 55 58.551 58.532 1 363 21 20
204 ACAAGCGTTACTCCAGAAACA CGAAGGGAAGCCAAGAACTTAA 42.857 45.455 57.812 58.591 192 395 21 22
272 GGACGAAGGTTATGAAGGACTT CTAGGAATGCTCATGTTGGGG 45.455 52.381 57.796 58.42 3 274 22 21