| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| Circ-FBXW7 | |||
| Gene | FBXW7 | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Glioma | ICD-10 | Malignant neoplasm of Brain, unspecified (C71.9) |
| DBLink | Link to database | PMID | PMC6019044 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | All glioma (n = 100, random World Health Organization [WHO] grade glioma; n = 38, glioblastoma and their paired periphery normal brain tissues) and normal brain tissues (n = 100) from traumatic decompression patients |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TTACAAAAACAAAATCCGGAGTCT ReverseTTTTCCTCTTCCTGGGTCTT | Statistics | Fold Change : Downregulated pvalue : <0.01 |
| Citation | |||
| PMC6019044 | |||