circad | circRNAs associated with diseases

circ-SHKBP1
Gene	SHKBP1	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	29499945
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Glioma tissue specimens were divided into two groups, grade I-II glioma group (LGG tissues, n = 5) and grade III-IV glioma group (HGGs, n = 5)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGGTCAGGCAGAGGAAGTCA Reverse CGCGTCATAACTGGTGATGG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
He, Q, Zhao, L, Liu, Y, Liu, X, Zheng, J, Yu, H, Cai, H, Ma, J, Liu, L, Wang, P, Li, Z, Xue, Y (2018). circ-SHKBP1 Regulates the Angiogenesis of U87 Glioma-Exposed Endothelial Cells through miR-544a/FOXP1 and miR-379/FOXP2 Pathways. Mol Ther Nucleic Acids, 10:331-348.