circad | circRNAs associated with diseases

circ-SMAD7
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Esophageal Squamous Cell Carcinoma (ESCC)	ICD-10	Oesophagus, unspecified (C15.9)
DBLink	Link to database	PMID	30611100
Experimental Method
Sample Type	Blood and Tissue samples	Comparison	Peripheral blood (5"�ml) of 32 ESCC patients and 6 paired ESCC tissues and adjacent noncancerous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGGGAGTGGCTGTGGATAA Reverse TCTCAAGAGGGATTTACAAACG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhang, Y, Wang, Q, Zhu, D, Rong, J, Shi, W, Cao, X (2019). Up-regulation of circ-SMAD7 inhibits tumor proliferation and migration in esophageal squamous cell carcinoma. Biomed. Pharmacother., 111:596-601.