circad | circRNAs associated with diseases

circDENND2A
Gene	DENND2A	Organism	Human
Genome Locus		Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink		PMID	30988674
Experimental Method
Sample Type	Tissue and cell lines	Comparison	The normal human astrocyte line SVGp12 and two human glioma cell lines, U87MG and A172
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGAACAGAAGACTGTGGACCG Reverse CAGTCTCTAGGAATGGAATGGAGG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Su, H, Zou, D, Sun, Y, Dai, Y (2019). Hypoxia-associated circDENND2A promotes glioma aggressiveness by sponging miR-625-5p. Cell. Mol. Biol. Lett., 24:24.