circad | circRNAs associated with diseases
circEIF4G2
 GeneEIF4G2OrganismHuman
 Genome LocusBuildhg19
 DiseaseCervical CancerICD-10 Malignant neoplasm of cervix uteri (C53)
 DBLinkPMID30896864
 Experimental Method
 Sample TypeTissue and cell linesComparison20 pairs of CC tissues and adjacent normal tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TTTTTCAACAAAGCAAGGTCAA

Reverse

TCTAGGTCCCACTGTCCTCA

StatisticsFold Change : Upregulated
pvalue : <0.05
 Citation
Mao, Y, Zhang, L, Li, Y (2019). circEIF4G2 modulates the malignant features of cervical cancer via the miR"218/HOXA1 pathway. Mol Med Rep, 19, 5:3714-3722.