| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circRNA7536 | |||
| Gene | ITGB6 | Organism | Human |
| Genome Locus | chr2:160169212-160196420:- | Build | hg19 |
| Disease | Esophageal Squamous Cell Carcinoma (ESCC) | ICD-10 | Oesophagus, unspecified (C15.9) |
| DBLink | Link to database | PMID | 29218114 |
| Experimental Method | |||
| Sample Type | Cell Lines | Comparison | SHEE and SHEEC cell lines. |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TGTAACCCAAGAACAAGTTCA ReverseGGTATCACACCTTTCGCCA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Sun, J, Yuan, X, Li, X, Wang, D, Shan, T, Wang, W, Wan, Q, Wang, X, Yan, J, Gao, S (2017). Comparative transcriptome analysis of the global circular RNAs expression profiles between SHEE and SHEEC cell lines. Am J Transl Res, 9, 11:5169-5179. | |||