circad | circRNAs associated with diseases

circTTBK2/hsa_circ_0000594
Gene	TTBK2	Organism	Human
Genome Locus	chr15:43120125-43164956:-	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	28219405
Experimental Method
Sample Type	Tissues and U87, U251 Cell lines	Comparison	glioma tissues compared with normal brain tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGTGCAACATTTTCCCTGGTG Reverse GCTTGATTTTGGCTTGGCTC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zheng, J, Liu, X, Xue, Y, Gong, W, Ma, J, Xi, Z, Que, Z, Liu, Y (2017). TTBK2 circular RNA promotes glioma malignancy by regulating miR-217/HNF1펲/Derlin-1 pathway. J Hematol Oncol, 10, 1:52.