circad | circRNAs associated with diseases

hsa-circ-0012129
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	29686222
Experimental Method
Sample Type	Cell Lines	Comparison	Thirty-one paired glioma tumor tissue samples, and adjacent non-tumor tissues and The human glioma cell lines U373, A172, and SHG44, and normal human astrocytes (NHA)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GATGACCGCAACCTATACCG Reverse AAGTAGAGGATGACGGCCAC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Xie, G (2018). Circular RNA hsa-circ-0012129 Promotes Cell Proliferation and Invasion in 30 Cases of Human Glioma and Human Glioma Cell Lines U373, A172, and SHG44, by Targeting MicroRNA-661 (miR-661). Med. Sci. Monit., 24:2497-2507.