circad | circRNAs associated with diseases

hsa_- circ_0067934
Gene	PRKCI	Organism	Human
Genome Locus	chr3:170013698-170015181:+	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	31646575
Experimental Method
Sample Type	Tissue and cell lines	Comparison	157-paired human GBM samples and the corresponding normal brain tissue specimens
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TTGCTGATATTCAGGGACAC Reverse CCTGTTTGAGGATGACAACC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Cui, XL, Wang, XD, Lin, SK, Miao, CM, Wu, M, Wei, JG (2019). Circular RNA circ_0067934 functions as an oncogene in glioma by targeting CSF1. Eur Rev Med Pharmacol Sci, 23, 19:8449-8455.