circad | circRNAs associated with diseases

hsa_circ_0001649
Gene	SHPRH	Organism	Human
Genome Locus	chr6:146209155-146216113:-	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	29421663
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	64 paired tissues and matched adjacent non-tumorous tissue specimens
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AATGCTGAAAACTGCTGAGAGAA Reverse TTGAGAAAACGAGTGCTTTGG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Ji, W, Qiu, C, Wang, M, Mao, N, Wu, S, Dai, Y (2018). Hsa_circ_0001649: A circular RNA and potential novel biomarker for colorectal cancer. Biochem. Biophys. Res. Commun., 497, 1:122-126.