| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0003586 | |||
| Gene | NF1 | Organism | Human |
| Genome Locus | chr17:29550461-29554624:+ | Build | hg19 |
| Disease | Gliomas | ICD-10 | Malignant neoplasm of Brain, unspecified (C71.9) |
| DBLink | Link to database | PMID | 28236760 |
| Experimental Method | |||
| Sample Type | Brain Tissues | Comparison | Five Glioblastoma Multiforme (GBM) and five normal brain specimens |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CCTTAACTATCCAAAAGCCAAA ReverseTCAATATTTCCCGCAACCAC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Zhu, J, Ye, J, Zhang, L, Xia, L, Hu, H, Jiang, H, Wan, Z, Sheng, F, Ma, Y, Li, W, Qian, J, Luo, C (2017). Differential Expression of Circular RNAs in Glioblastoma Multiforme and Its Correlation with Prognosis. Transl Oncol, 10, 2:271-279. | |||