circad | circRNAs associated with diseases

hsa_circ_0008344
Gene	UBAP2	Organism	Human
Genome Locus	chr9:33935836-33941860:-	Build	hg19
Disease	Glioblastoma	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	29687495
Experimental Method
Sample Type	Tissues	Comparison	4 pairs of glioblastoma tissue and corresponding adjacent brain tissue
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCAGGAGGTAATGACGGAAG Reverse TGGTCGAAGTCAGCAGACAC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhou, J, Wang, H, Chu, J, Huang, Q, Li, G, Yan, Y, Xu, T, Chen, J, Wang, Y (2018). Circular RNA hsa_circ_0008344 regulates glioblastoma cell proliferation, migration, invasion, and apoptosis. J. Clin. Lab. Anal., 32, 7:e22454.