circad | circRNAs associated with diseases

hsa_circ_0046701
Gene	YES1	Organism	Human
Genome Locus	chr18:745707-751804:-	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	29337055
Experimental Method
Sample Type	NHAs and U251,U373,SHG44 Cell lines	Comparison	Normal human astrocytes (NHAs) and glioma cell lines (U251, U373, and SHG44)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CACAACCAGAGCACAATTTGA Reverse TGGATCATCAACCAGCTCAG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, G, Yang, H, Han, K, Zhu, D, Lun, P, Zhao, Y (2018). A novel circular RNA, hsa_circ_0046701, promotes carcinogenesis by increasing the expression of miR-142-3p target ITGB8 in glioma. Biochem. Biophys. Res. Commun., 498, 1:254-261.