circad | circRNAs associated with diseases

hsa_circ_0067934
Gene	PRKCI	Organism	Human
Genome Locus	chr3:170013698-170015181:+	Build	hg19
Disease	Esophageal Squamous Cell Carcinoma (ESCC)	ICD-10	Oesophagus, unspecified (C15.9)
DBLink	Link to database	PMID	27752108
Experimental Method
Sample Type	Tissues	Comparison	primary Esophageal Squamous Cancer (ESCC) tissues and adjacent normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAGCAGTTCCCCAATCCTTG Reverse CACAAATTCCCATCATTCCC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Xia, W, Qiu, M, Chen, R, Wang, S, Leng, X, Wang, J, Xu, Y, Hu, J, Dong, G, Xu, PL, Yin, R (2016). Circular RNA has_circ_0067934 is upregulated in esophageal squamous cell carcinoma and promoted proliferation. Sci Rep, 6:35576.