Aliases Ac_ciRNA_00510 Scientific name Actinidia deliciosa
Organism Kiwi fruit Genome Locus n/a
CircRNA type n/a Gene ID n/a
Gene Name n/a Detection pipeline CIRI
Sample Type leaf;root;stem tissues
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Aliases Ac_ciRNA_00510 Scientific name Actinidia deliciosa
Organism Kiwi fruit Genome Locus n/a
CircRNA type intron Gene ID n/a
Gene Name n/a Detection pipeline CIRI
Sample Type leaf;root;stem tissues
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGGCAAATGAATACGG
Reverse Primer CCTTGCACGCCTTGCTAAAGATGAA
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size