| Aliases | circRNA_0827 | Scientific name | Bombyx mori | ||||
| Organism | Silkworm | Genome Locus | NW_004581686.1:808278-818489:- | ||||
| CircRNA type | sense-overlapping | Gene ID | n/a | ||||
| Gene Name | LOC101742624 | Detection pipeline | find_circ | ||||
| Sample Type | midgut following Bombyx mori cytoplasmic polyhedrosis virus infection | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | circRNA_0827 | Scientific name | Bombyx mori | ||||
| Organism | Silkworm | Genome Locus | n/a | ||||
| CircRNA type | sense-overlapping | Gene ID | n/a | ||||
| Gene Name | LOC101742624 | Detection pipeline | find_circ | ||||
| Sample Type | midgut following Bombyx mori cytoplasmic polyhedrosis virus infection | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGCTTCAGGTCTCTGTGAACG | ||||||||
| Reverse Primer | CTCAAGGCTCTGTACGTGAGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |