| Aliases | circRNA_2439-Q | Scientific name | Bombyx mori | ||||
| Organism | Silkworm | Genome Locus | n/a | ||||
| CircRNA type | sense-overlapping | Gene ID | n/a | ||||
| Gene Name | LOC101744022 | Detection pipeline | find_circ | ||||
| Sample Type | midgut following Bombyx mori cytoplasmic polyhedrosis virus infection | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCGGACTACGACAACGAGCT | ||||||||
| Reverse Primer | CCGTAGATGAAGGCGCACC | ||||||||