| Aliases | cel_circ_0000040 | Scientific name | Caenorhabditis elegans | ||||
| Organism | Nematode | Genome Locus | chrI:2478227-2478800:- | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | abtm-1 | Detection pipeline | n/a | ||||
| Sample Type | L4 larval stage | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GTTGCGGAGCTCGTTGAATA | ||||||||
| Reverse Primer | ACTTCATCGTTGGCTCTGCT | ||||||||