Aliases cel_circ_0000040 Scientific name Caenorhabditis elegans
Organism Nematode Genome Locus chrI:2478227-2478800:-
CircRNA type n/a Gene ID n/a
Gene Name abtm-1 Detection pipeline n/a
Sample Type L4 larval stage
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GTTGCGGAGCTCGTTGAATA
Reverse Primer ACTTCATCGTTGGCTCTGCT
Aliases cel_circ_0000040 Scientific name Caenorhabditis elegans
Organism Nematode Genome Locus chrI:2478227-2478800:-
CircRNA type n/a Gene ID WBGene00022281
Gene Name abtm-1 Detection pipeline find_circ
Sample Type L4 larval stage
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size