Aliases cel_circ_0000438 Scientific name Caenorhabditis elegans
Organism Nematode Genome Locus n/a
CircRNA type n/a Gene ID n/a
Gene Name n/a Detection pipeline n/a
Sample Type L4 larval stage
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CACAGCCCAAAGTTTCAGTC
Reverse Primer AAGCGGCAGCGATCGCCGC
Aliases cel_circ_0000438 Scientific name Caenorhabditis elegans
Organism Nematode Genome Locus chrIII:11688125-11688336:+
CircRNA type n/a Gene ID WBGene00000793
Gene Name crh-1 Detection pipeline find_circ
Sample Type L4 larval stage
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size