| Aliases | chr2R:20659249-20660318_- | Scientific name | Drosophila melanogaster | ||||
| Organism | Fruitfly | Genome Locus | chr2R:20659249-20660318:- | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | Eps-15 | Detection pipeline | n/a | ||||
| Sample Type | Neural Tissues | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | Eps-15_circ | Scientific name | Drosophila melanogaster | ||||
| Organism | Fruit fly | Genome Locus | chr2R:20659249-20660318:. | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | Eps-15 | Detection pipeline | n/a | ||||
| Sample Type | Neural Tissues | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATTTGCCGACTTTGACGACT | ||||||||
| Reverse Primer | AGCGTTTTGCGTTTAATTCG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |