| Aliases | Muscle4 | Scientific name | Zebrafish | ||||
| Organism | Danio rerio | Genome Locus | chr5:55638223-55644350 | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | srek1 | Detection pipeline | FindCirc | ||||
| Sample Type | Muscle | ||||||||
| Method for Estimation | Quantitative-PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TGCTGTCTGCCATCTTCACT | ||||||||
| Reverse Primer | TACCTGTTGCCATATGCCCA | ||||||||
| Aliases | Muscle_circ_002260 | Scientific name | Zebrafish | ||||
| Organism | Danio rerio | Genome Locus | chr5:55638223-55644350:- | ||||
| CircRNA type | n/a | Gene ID | ENSDARG00000009764 | ||||
| Gene Name | n/a | Detection pipeline | FindCirc | ||||
| Sample Type | Muscle | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |