| Aliases | circ_000986 | Scientific name | Zebrafish | ||||
| Organism | Danio rerio | Genome Locus | n/a | ||||
| CircRNA type | sense overlapping | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | CIRI; Find_circ and Segemehl | ||||
| Sample Type | brain;eyes;heart;liver;spleen;kidney;intestines;skin;muscle;gill;ovary; testis | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATTCTGCGGGTTCTTCGTC | ||||||||
| Reverse Primer | TGCTTCTGGTTTGTCTCACG | ||||||||